Protocol for zebra fish in situ hybridization in 96 well flat bottom microtiter plate.

(this protocol was developed by Chris Lau, Shelly Oommen, Jianfeng Li, and James (Hung-Chun) Yu by modification of the single tube hybridization protocol available at zfin.org and is useful for both single stranded RNA or DNA probes)  - June 3, 2005

Day1

 

Steps 1-4 is carried out in 1.5ml Eppendorf tubes

 

Embryos were stored at -20 deg C in 100% methanol

 

1)  Re-hydration of the embryos :

1.  1:3 1xPBST:Methanol   1ml   shake at RT for 5 min

2.  1:1 1xPBST:Methanol   1ml   shake at RT for 5 min

3.  3:1 1xPBST:Methanol   1ml   shake at RT for 5 min

4.  100%  1x PBST             1ml   shake at RT for 5 min

2)  Permeabilization of the embryo:

1ul of Proteinase k (10mg/ml) is added to embryos in 1 ml PBST followed by

1.  24 hpf embryo     1: 30 min shaking

2.  48 hpf embryo     8 00 min shaking

3.  72hpf embryo      8: 00 min shaking, and 8:00 min of still sitting

(Embryos before 24hpf need no permeabilization)

3) Immediate washes with PBST and PFA fixation:

1.  1 ml  glycine (2.5 mg/ml) in PBST and shake at RT 5 min

2.  1 ml  1x PBST  shake at RT  5 min

3.  1 ml  1x PBST  shake at RT  5 min

4.  1 ml  1x PBST  shake at RT  5 min

5.  1 ml   4% PFA. sit at RT   20 min

4)  Washes for removing PFA

1. 1ml 1x  PBST shake 5min RT

2. 1ml 1x  PBST shake 5min RT

3. 1ml 1x  PBST shake 5min RT

4. 1ml 1x  PBST shake 5min RT

5. 1ml 1x  PBST shake 5min RT

5) Distribution of the embryos:

   Transfer embryos into two 96 well microtiter plate. (24hpf: 500 embryos, 48hpf: 500 embryos, 72hpf: 500 embryos per 96 well plate are required).  In a typical plate, 5 embryos from each of several stages are pooled into each well.  ~15 embryos per well seems to be ideal.  If 3 stages are pooled use 5 embryos per stage, if 4 stages are pooled use 4 embryos per stage, and if 5 stages are pooled use 3 embryos per stage.

6) Pre-hybridization:

Carefully remove and discard the 1X PBST solution using a 12 channel pipette, leaving the embryos intact in the wells. Then add 200 ul hybridization buffer containing yeast tRNA to each well and incubate for at least1 hr (2-3hrs in this experiment) at 50 deg C in a water bath.

Probe preparation: 

Dispense 100 ul hybridization buffer with yeast tRNA into each well of a fresh 96 well microtiter plate.  Then add  ~5 ul of probe to each well and denature the probes by heating the plate at 95 deg C for 10 min, followed by keeping on ice at -20 deg C.

 

7)  Hybridization:

Carefully remove and discard the hybridization solution using a 12 channel pipette, leaving the embryos intact in the wells.  Then transfer the probe solution (~100 ul) into the 96-well embryo plate using the Hydra.  Carefully seal the plate and incubate overnight in a 50 deg C water bath.

Note: For DNA probes it often is useful to do the hybridization at 50, 55, and 60 deg C in a preliminary experiment to determine the optimal hybridization temperature.

For RNA probes a higher hybridization temperature (60, 65 and 70 deg C) often is useful but a temperature study should be done to determine the optimal hybridization results here as well.

 

Day2

 

Post Hybridization Wash:

1.     Carefully remove and discard the probe solution (by 12-channel) leaving the embryos intact in the wells, Then add 250 ul of hybridization buffer (by 12-channel). Keep in 65 deg C for 5 min with the plate unsealed. 

Note: Prior to each of the following steps, without disrupting the embryos, carefully remove and discard as much of the previous wash solution as possible using the Hydra.   Here the high of the Hydra needles should be adjusted such that only 200 ul of the ~250 ul is removed and ~50 ul remains containing the intact, undisturbed embryos.

2.     Add 200 ul Hybridization buffer and keep in 65°C water bath for 5 min.

3.     Add 200 ul 3:1 Hyb:2X SSC (0.2% Tween20) and keep in 65 deg C water bath for 5 min.

4.     Add 200 ul 3:1 Hyb:2X SSC (0.2% Tween20) and keep in 65 deg C water bath for 5 min.

5.     Add 200 ul 1:1 Hyb:2X SSC (0.2% Tween20) and keep in 65 deg C water bath for 5 min.

6.     Add 200 ul 1:1 Hyb:2X SSC (0.2% Tween20) and keep in 65 deg C water bath for 5 min.

7.     Add 200 ul 1:3 Hyb:2X SSC (0.2% Tween20) and keep in 65 deg C water bath for 5 min.

8.     Add 200 ul 1:3 Hyb:2X SSC (0.2% Tween20) and keep in 65 deg C water bath for 5 min.

9.     Add 200 ul 100% 2X SSC (0.1% Tween20) and keep in 65 deg C water bath for 5 min.

10.  Add 200 ul 100% 2X SSC (0.1% Tween20) and keep in 65 deg C water bath for 5 min.

11.  Add 200 ul 0.2X SSC (0.1% Tween20) and keep in 65 deg C water bath for 15 min.

12.  Add 200 ul 0.2X SSC (0.1% Tween20) and keep in 65 deg C water bath for 15 min.

13.  Add 200 ul 0.2X SSC (0.1% Tween20) and keep in 65 deg C water bath for 15 min.

14.  Add 200 ul 0.2X SSC (0.1% Tween20) and keep in 65 deg C water bath for 15 min.

15.  Add 200 ul 3:1 0.2X SSC/PBST (0.01% Tween20) and Shake in RT for 5 min.

16.  Add 200 ul 3:1 0.2X SSC/PBST (0.01% Tween20) and Shake in RT for 5 min

17.  Add 200 ul 1:1 0.2X SSC/PBST (0.01% Tween20) and Shake in RT for 5 min

18.  Add 200 ul 1:1 0.2X SSC/PBST (0.01% Tween20) and Shake in RT for 5 min

19.  Add 200 ul 1:3 0.2X SSC/PBST (0.01% Tween20) and Shake in RT for 5 min

20.  Add 200 ul 1:3 0.2X SSC/PBST (0.01% Tween20) and Shake in RT for 5 min

4) Washes:

1. Add 200 ul PBST and Shake in RT for 5 min.

2. Add 200 ul PBST and Shake in RT for 5 min.

Blocking:

1.     Carefully remove and discard the 1X PBST buffer (12-channel) without disrupting the embryos.  Then, add 200 ul of blocking solution (12-channel), seal the plate with transparent sealer, and shake on bench shaker at RT for 2 hrs at a setting of 3.5.

Antibody(Ab) Detection

1.   Carefully remove and discard the 200 ul blocking solution (12-channel) and add 100 ul of 1: 10,000 dilution Dig-Fab Ab in blocking solution.

2.  Shake in the cold room on a bench shaker at setting of 2 overnight.

 

Day3

 

Washing excess antibody(Ab) with 1X PBST:

1.     Carefully remove and discard the 200 ul of Ab/blocking solution (12-channel).  Then, add 250 ul of 100% PBST (12-channel), and shake at rate 3 for 7.5 min at RT.  Carefully remove the Ab/blocking solution using the 12 channel.

Note: Prior to each of the following steps, without disrupting the embryos, carefully remove and discard as much of the previous wash solution as possible using the Hydra.  Again, adjusting the height of the needles such that all but 50 ul of the liquid is removed and the embryos remain undisturbed and intact.

2.     Add 200 ul of 100% PBST, and shake at rate 3 for 7.5 min at RT.

3.     Add 200 ul of 100% PBST, and shake at rate 3 for 7.5 min at RT.  

4.     Add 200 ul of 100% PBST, and shake at rate 3 for 7.5 min at RT.

5.     Add 200 ul of 100% PBST, and shake at rate 3 for 7.5 min at RT.

6.     Add 200 ul of 100% PBST, and shake at rate 3 for 7.5 min at RT.

7.     Add 200 ul of 100% PBST, and shake at rate 3 for 7.5 min at RT.

8.     Add 200 ul of 100% PBST, and shake at rate 3 for 7.5 min at RT.

9.     Add 200 ul of 100% PBST, and shake at rate 3 for 7.5 min at RT.

10.  Add 200 ul of 100% PBST, and shake at rate 3 for 7.5 min at RT.

11.  Add 200 ul of 100% PBST, and shake at rate 3 for 7.5 min at RT.

12.  Add 200 ul of 100% PBST, and shake at rate 3 for 7.5 min at RT.

13.  Add 200 ul of 100% PBST, and shake at rate 3 for 7.5 min at RT.

14.  Add 200 ul of 100% PBST, and shake at rate 3 for 7.5 min at RT.

15.  Add 200 ul of 100% PBST, and shake at rate 3 for 7.5 min at RT.

16.  Add 200 ul of 100% PBST, and shake at rate 3 for 7.5 min at RT.

Washes of NTMT – the staining buffer:

1.     Carefully remove and discard the 1X PBST (12-channel).  Then add 250 ul of NTMT (12-channel), and shake at rate 3 for 5 min in RT.

2.     Add 200 ul of NTMT, and shake at rate 3 for 5 min in RT.

3.     Add 200 ul of NTMT, and shake at rate 3 for 5 min in RT.

4.     Add 200 ul of NTMT, and shake at rate 3 for 5 min in RT.

 

Colorization:

1.   Carefully remove and discard the entire NTMT and then add 100ul of NTMT with dyes (NBT 4.5ul/ml of NTMT + BCIP 3.5ul/ml of NTMT) and shake at a setting of 3 at RT.

2.   Check to determine if a staining pattern can be detected, by viewing the embryos directly in the microtiter plate using the Olympus SZ60 optical microscope periodically (approximately every hour or so to overnight). 

3.   Once a clear staining pattern is observed, stop any further staining by removing the NTMT with dyes using the Hydra, and wash the embryos several times with ~100 ul of 1xPBST.

 

Controls:

Both a positive and negative control probe typically is hybridized in parallel with any experimental probes.

For example, either Krox 20 (aka EGR2b, which is useful for developmental stages up to 24 hpf - see EGR2b on zfin.org) or OTP (which is useful for developmental stages above 24 hpf - see zfin.org) often serve as useful positive controls depending on the stages being studied.  These probes were produced as single stranded DNAs from cloned exons after exon-specific genomic PCR.

As a negative control, do not add any probe to at least one well to see background, non-specific Ab-staining without probe.  Alternatively it often is useful to do a 1X and 5X protease treatment and compare the results.

 

 

 

Reagents for in situ hybridization

500 ml of 4% Paraformaldehyde (PFA)

1.   Heat 450 ml of dH2O to 60 deg C.

2.   With stirring, add 20 g of paraformaldehyde powder to the heated water. Cover and maintain at 60 deg C on a hot plate.

3.   Add 5 drops of 2N NaOH (1 drop per 100 ml). The solution should be clear within a couple of minutes (There will be some fine particles that will not go away). Do not heat the solution above 70 deg C. PFA will break down at temperatures above 70 deg C.

4.   Remove from heating and add 50 ml of 10X PBS. Adjust pH to 7.2 using HCl if necessary. Filter and place on ice.

5.   Store at -20 deg C.

 

Glycine solution (10ml):

25mg of glycine powder in 10ml of H2O.

 

10 X PBS  (1 L)

NaCl                               80 g

KCl                                   2 g

Na2HPO4 (anhydrous)        11.1 g

KH2PO4                           2  g

Adjust the volume to 1L with additional ddH2O

 

1X PBST (1L)

10X PBS                  100 ml

20% Tween 20           10 ml

dd H2O                     890 ml

 

20 X SSC

1. Dissolve 175.3 g of NaCl and 88.2 g of sodium citrate in 800ml of distilled H2O.

2. Adjust the pH to 7.0 with a few drops of 1M HCl.

3. Adjust the volume to 1L with additional ddH2O.

4. Autoclaving.

 

Hybridization Solution (50 ml) :

                                                    Volume              Final concentration

100%  Formamide                      25ml                           50%

20 X SSC                                 12.5ml                             5X

5mg /ml Heparin                        500ul                     50ug/ml

Yeast tRNA (25mg/ml)              10ml                      5mg/ml

20% Tween 20                           500ul                          0.2%

1M Citric Acid pH = 6               460ul

ddH2O                                      1.04ml

(* 7~8 tubes of 10ml yeast tRNA is enough for experiment using 2 96-well plate)

 

Blocking Solution (50 ml):

BSA                                       100 mg

Sheep serum  (6 mg/ml)             1 ml

Adjust the volume to 50ml with additional ddH2O.

 

NTMT (50 ml):

5M NaCl                       1 ml

1M MgCl2                  2.5 ml

1M Tris pH 9.5             5 ml

20% Tween 20          250  ul

ddH2O                    41.25 ml

 

20 X SSC

1 Dissolve 175.3 g of NaCl and 88.2 g of Sodium Citrate in 800ml of distilled H2O

2 Adjust the pH to 7.0 with a few drops of 1M HCl

3 Adjust the volume to 1L with additional ddH2O

4 Autoclave and bring the final volume to 1L with additional ddH2O

 

Exon specific ssDNA probes

 

Primer picking:

1.   Obtain exon sequence from databases (eg. Ensembl, NCBI, UCSC).

2.   Use PRIMOU to pick nested pairs of primers specific to each exon.

 

Isolation of zebrafish genomic DNA:

1.   Collect ~7days old zebrafish embryos.

2.   Distribute ~50 embryos into 1.5ml Eppendorf tubes.

3.   Rinse embryos with ddH2O twice, and carefully remove all liquid.

4.   Add 1ml DNA extraction buffer and incubate in 50 deg C water bath overnight.

5.   Homogenized embryos then are subjected to phenol extraction and ethanol precipitation.

6.   The precipitated DNA then is dissolved in ddH2O and concentration of DNA is measured.  Typically the DNA should be at a concentration of 40 ngm/ul

 

Exon specific genomic PCR:

1.   The first round PCR is done by using zebra fish genomic DNA and touchdown cycling program.  The touchdown program is as follows.

94 deg C 2min

 

65 deg C for the first 2 cycles

 

63 deg C for the next 3 cycles

 

61 deg C for the next 4 cycles

30cycles
 
94 deg C 1min

60 deg C for the next 4 cycles

65~50 deg C 1min

58 deg C for the next 4 cycles

72 deg C 2min

56 deg C for the next 4 cycles

54 deg C for the next 4 cycles

 

52 deg C for the next 3 cycles

 

50 deg C for the next 2 cycles

 

 

10cycles
 
94 deg C 1min

 

58 deg C 1min

 

72 deg C 2min

 

 

 

 

72 deg C 5min

 

 

 

 

 

 

4 deg C ∞

 

 

2. The EXO I/SAP cleaned-up first round PCR product is used as template for the second round of nested PCR (with nested primer set) using the above PCR cycles).

 

Verification and purification of template for probes:

 

1.   The PCR products either are sequenced directly or cloned into pUC18 (following the established cloning protocol) before sequencing.

2.   The verified and conformed PCR products are purified on a low melt gel and extracted from the gel by excising the gel piece using a sterile razorblade, freezing it at -70 for at least an hour, centrifuging and then pipetting the liquid above the pelleted agarose to a fresh tube, followed by concentration via ethanol precipitation.  (For the cloned PCR product, an additional PCR is performed and the PCR product is purified on a low melt gel)

 

ssDNA probe labeling – unidirectional amplification:

The unidirectional amplification to produce a ssDNA probe is done by using one of nested primers, the purified PCR product as template, and PCR DIG labeling mix (Roche 1585550).    The PCR cycles are as follow.

94 deg C 2min

 

 

 

 

 

 

35cycles
 
94 deg C 1min

 

55 deg C 1min

 

72 deg C 1min

 

 

 

 

72 deg C 5min

 

 

 

 

 

 

4 deg C ∞

 

 

Reagents for probe synthesis

DNA extraction buffer

10mM

Tris pH 8.2

10mM

EDTA

200mM

NaCl

0.5%

SDS

200ug/ml

ProteinaseK

 

PCR primers used for controls:

 

For Krox 20:

            First PCR primer pairs:

5’ CCAGTGTCGGATATGCATGA 3’

5’ AGCTGGACACTCCTGTGGAC 3’

            Second, nested PCR primer pairs

5’ ACTTTAGTCGCAGCGACCAC 3’

5’ ACGAGGAGGACTTTCGCTCT 3’

 

For OTP:

            First PCR:

            5’ CAAGAAGACCACCAACGTGT 3’

         5’ AGCTCATGGACACTGTGTGC 3’

            Second, nested PCR

5’ TGGGCGATAGCCTATGCTCT 3’

5’ GGGTTGGTAGAGGTGGGACT 3’