APPENDIX

Solutions

10X ABI TBE:

		216 g  Tris base
		110 g  boric acid
		16.6 g EDTA
	Add water to 2 liters.

40% Acrylamide/Bisacrylamide (40% A&B):

		380 g	Acrylamide (Kodak 5521)
		 20 g	N,N-Methylene-bisacrylamide (Kodak 8383)

Dissolve in approx. 800 ml of double distilled water and then deionize by stirring with 50 g of Amberlite MB-1 (Sigma MB-1A) for 1 hour at room temperature. Suction filter to remove the Amberlite and adjust to a final volume of 1 liter with double distilled water. (store at 4deg.C).

10x Agarose gel loading dye: 15% Ficoll, 0.2% bromophenol blue, 0.2% xylene cyanol FF in double distilled water.

		1.5 g		Ficoll (Sigma F-2637)
		0.02 g		Bromophenol blue (Sigma B-0126)
		0.02 g		xylene cyanole FF (Kodak T-1579)
		ddH2O to 10 ml (store at -20deg.C).

Alkaline lysis solution (NaOH/SDS): 0.2 N NaOH, 1% SDS in ddwater.

		20 ml of 1 N NaOH (or 0.8 gms)
		10 ml of 10% SDS (or 1.0 gms)
		ddH2O to 100 ml (make fresh)

15% Ammonium persulfate (APS):

		1.5 g		APS (Kodak 11151)
		ddH2O to 10 ml (store at 4deg.C).

Ampicillin (Amp): Stock of 5 mg/ml in sterile ddwater (sddH2O).

		0.5 g		Amp (Sigma A-9518)
		sddH2O to 100 ml (Add to media for final conc. 100 ug/ml)

100 mM rATP (adenosine triphosphate):

		619 mg	dipotassium ATP (ICN 100004)
		sddH2O to 10 ml (aliquot and store at -20deg.C).

1 mg/ml BSA (bovine serum albumin):

		5 mg		BSA (Sigma A-9647)
		sddH2O to 5 ml (aliquot and store at -20deg.C)

Bst dilution buffer: 50 mM HEPES, pH 7.6, 10 mM MgCl2, 1 mM DTT, and 1 mg/ml BSA in sterile double distilled water.

		500 ul		1 M HEPES, pH 7.6
		100 ul		1 M MgCl2
		10 ul		1 M DTT
		10 mg		BSA
		sddH2O to 10 ml

Bst reaction buffer: 500 mM Tris-HCl, pH 8.5 and 150 mM MgCl2 in sterile double distilled water.

		5 ml		1 M Tris-HCl, pH 8.5
		1.5 ml		1 M MgCl2
		sddH2O to 10 ml

Bst nucleotide extension mix: 15 uM dCTP, 7deaza-dGTP, and dTTP in 5 mM Tris-HCl, pH 7.6 and 0.1 mM EDTA

		3 ul		5 mM dCTP
		3 ul		5 mM 7deaza-dGTP
		3 ul		5 mM dTTP
		100 ul		50:1 TE buffer
		891 ul	sddH2O
		1 ml

Bst "short" termination "A" mix: 8 uM dATP, 164 uM dCTP, 164 uM 7deaza-dGTP, 164 uM dTTP, 660 uM ddATP in 5 mM Tris-HCl, pH 7.6 and 0.1 mM EDTA.

		8 ul 		0.5 mM dATP
		16.4 ul		5 mM dCTP
		16.4 ul		5 mM 7deaza-dGTP
		16.4 ul		5 mM dTTP
		66 ul		5 mM ddATP
		50 ul		50:1 TE buffer
		326.8 ul	sddH2O
		500 ul
	aliquot (18 ul for 6 reactions) and store at -70degC

Bst "short" termination "C" mix: 8 uM dCTP, 164 uM dATP, 164 uM 7deaza-dGTP, 164 uM dTTP, 400 uM ddCTP in 5 mM Tris-HCl, pH 7.6 and 0.1 mM EDTA.

		16.4 ul 	5 mM dATP
		8 ul		0.5 mM dCTP
		16.4 ul		5 mM 7deaza-dGTP
		16.4 ul		5 mM dTTP
		40 ul		5 mM ddCTP
		50 ul		50:1 TE buffer
		352.8 ul	sddH2O
		500 ul
	aliquot (18 ul for 6 reactions) and store at -70degC

Bst "short" termination "G" mix: 8 uM dGTP, 164 uM dATP, 164 uM dCTP, 164 uM dTTP, 540 uM ddGTP in 5 mM Tris-HCl, pH 7.6 and 0.1 mM EDTA.

		16.4 ul     	5 mM dATP
		16.4 ul     	5 mM dCTP
		8 ul        	0.5 mM 7deaza-dGTP
		16.4 ul     	5 mM dTTP
		54 ul       	5 mM ddGTP
		50 ul       	50:1 TE buffer
		338.8 ul	sddH2O
		500 ul
	aliquot (18 ul for 6 reactions) and store at -70degC

Bst "short" termination "T" mix: 8 uM dTTP, 164 uM dATP, 164 uM dCTP, 164 uM dTTP, 600 uM ddTTP in 5 mM Tris-HCl, pH 7.6 and 0.1 mM EDTA.

		16.4 ul 	5 mM dATP
		16.4 ul		5 mM dCTP
		16.4 ul		5 mM 7deaza-dGTP
		8 ul		0.5 mM dTTP
		60 ul		5 mM ddTTP
		50 ul		50:1 TE buffer
		332.8 ul	sddH2O
		500 ul
	aliquot (18 ul for 6 reactions) and store at -70degC

Bst "long" termination "A" mix: 8 uM dATP, 164 uM dCTP, 164 uM 7deaza-dGTP, 164 uM dTTP, 110 uM ddATP in 5 mM Tris-HCl, pH 7.6 and 0.1 mM EDTA.

		8 ul 		0.5 mM dATP
		16.4 ul		5 mM dCTP
		16.4 ul		5 mM 7deaza-dGTP
		16.4 ul		5 mM dTTP
		11 ul		5 mM ddATP
		50 ul		50:1 TE buffer
		381.8 ul	sddH2O
		500 ul
	aliquot (18 ul for 6 reactions) and store at -70degC

Bst "long" termination "C" mix: 8 uM dCTP, 164 uM dATP, 164 uM 7deaza-dGTP, 164 uM dTTP, 65 uM ddCTP in 5 mM Tris-HCl, pH 7.6 and 0.1 mM EDTA.

		16.4 ul 	5 mM dATP
		8 ul		0.5 mM dCTP
		16.4 ul		5 mM 7deaza-dGTP
		16.4 ul		5 mM dTTP
		6.5 ul		5 mM ddCTP
		50 ul		50:1 TE buffer
		386.3 ul	sddH2O
		500 ul
	aliquot (18 ul for 6 reactions) and store at -70degC

Bst "long" termination "G" mix: 8 uM dGTP, 164 uM dATP, 164 uM dCTP, 164 uM dTTP, 70 uM ddGTP in 5 mM Tris-HCl, pH 7.6 and 0.1 mM EDTA.

		16.4 ul 	5 mM dATP
		16.4 ul		5 mM dCTP
		8 ul		0.5 mM 7deaza-dGTP
		16.4 ul		5 mM dTTP
		7 ul		5 mM ddGTP
		50 ul		50:1 TE buffer
		385.8 ul	sddH2O
		500 ul
	aliquot (18 ul for 6 reactions) and store at -70degC

Bst "long" termination "T" mix: 8 uM dTTP, 164 uM dATP, 164 uM dCTP, 164 uM dTTP, 150 uM ddTTP in 5 mM Tris-HCl, pH 7.6 and 0.1 mM EDTA.

		16.4 ul 	5 mM dATP
		16.4 ul		5 mM dCTP
		16.4 ul		5 mM 7deaza-dGTP
		8 ul		0.5 mM dTTP
		15 ul		5 mM ddTTP
		50 ul		50:1 TE buffer
		377.8 ul	sddH2O
		500 ul
	aliquot (18 ul for 6 reactions) and store at -70degC

100 mM calcium chloride (CaCl2):

		1.48 g		CaCl2-2H2O
		ddH2O to 100 ml
	autoclave to sterilize (store at 4deg.C).

50 mM calcium chloride:

		0.74 g		CaCl2-2H2O
		ddH2O to 100 ml
	autoclave to sterilize (store at 4deg.C).

Chloramphenicol 10 mg/ml stock:

		2 g Chloramphenicol (Sigma C-0378)
		200 ml 100% (or 95%) ethanol
		Final volume 200 ml

Sterilize by filtering through a Nalgene filter (#8-0000-22 0301)
Store in the cold room in a foil wrapped screw cap Nalgene bottle
Use as an additive to microbial growth media at a final concentration of 15 ug/ml media.
For 200 ml media, add 300 ul of 10 mg/ml chloramphenicol stock.
For 1 liter media, add 1.5 ml of 10 mg/ml chloramphenicol stock.

Deionized formamide: Stir formamide (Schwarz/Mann Biotech 800686) with Amberlite MB resin, 10 g. per 100 ml, for one hour to deionize; filter through Whatman 3MM paper, store in a dark bottle at room temperature or 4deg.C.

10X denaturing buffer: 200 mM Tris-HCl, pH 9.5, 1 mM EDTA, 10 mM spermidine in double distilled water.

		2 ml		1 M Tris-HCl, pH 9.5
		20 ul		0.5 M EDTA, pH 8.0
		1 ml		100 mM spermidine
		ddH2O to 10 ml (aliquot and store at -20degC)

Diatomaceous earth (100 mg/ml): Suspend 10 g of diatomaceous earth (Sigma D-5384) in 100 ml of distilled water in a 100 ml graduated cylinder, and let it settle down for 3 hours. Decant the supernatant, and resuspend the pellet in 100 ml of 6 M guanidine HCl, pH 6.4, containing 50 mM Tris-HCl, 20 mM EDTA.

Diatomaceous earth-wash buffer: 10 mM Tris-HCl, pH 8.0, 1 mM EDTA, pH 8.0, 50% ethanol in double distilled water.

		10 ml		1 M Tris-HCl, pH 8.0
		2 ml		0.5 M EDTA, pH 8.0
		500 ml		100% ethanol (McCormick Distilling Co., Inc.)
		ddH2O to 1 L

1 M DTT (Dithiothreitol, Cleland's reagent):

		1.54 g		DTT (Calbiochem 233155)
		ddH2O to 10 ml (aliquot and store at -20deg.C).

DNase-free RNase A: 20 mg/ml RNase A in 1 mM NaOAc, pH 4.5.

		200 mg		RNase A (Sigma R-5500)
		3.3 ul		3 M NaOAc, pH 4.5 
		ddH2O to 10 ml 
	boil for 10 minutes (aliquot and store at -20deg.C).

0.5 M EDTA, pH 8.0 (disodium ethylenediamine tetraacetate):

		186.1 g	Na2EDTA

Dissolve in approx. 400 ml ddH2O, adjust pH to 8.0 with 10 N NaOH, and adjust to 1 liter final volume with distilled water.

100 mM EDTA:

		20 ml		0.5 M EDTA
		80 ml	ddH2O 
		100 ml

25mM EDTA, 50 mg/ml Blue Dextran - ABI377 Loading Dye/Formamide mixture: Add 0.93g of EDTA to 90 ml water. Then, adjust the pH to 8.0. Bringthe final volume to 100 ml. Next, add 50 mg Blue Dextran to a 1 ml EDTA solution. Add 1 ul of a 1:5 solution of this loading dye:deionized formamide to each sample well for loading onto the ABI377

95% ethanol/0.12 M NaOAc (ethanol/acetate):

		95 ml		100% ethanol
		4 ml		3 M NaOAc pH 4.5
		1 ml		ddH2O
		100 ml

5 mg/ml ethidium bromide (EtBr):

		500 mg	EtBr (Sigma E-8751)
		ddH2O to 100 ml

10X Freezer Media (FM) for storing either shotgun plasmid-based sub-clone or cDNA clones in microtiter plates):


          Final Concentration       1L        500 ml      250 ml
          -------------------     -------    --------    -------
          360 mM K2HPO4           62.7 gm    31.35 gm    15.68 gm  
          132 mM KH2PO4           17.96 gm    8.98 gm     4.49 gm
          17 mM Sodium Citrate     5.0 gm     2.5 gm      1.25 gm
          4 mM MgSO4.7H2O          0.98 gm    0.49 gm     0.24 gm
          (or 1M MgSO4             4 ml       2 ml        1 ml)
          68 mM (NH4)2SO4          8.98 gm    4.49 gm     2.25 gm
          44% Glycerol             440 ml     220 ml      110 ml

          Bring to volume with dH2O
          Sterilize by filtration throught 0.2um filter

Then the final growth and storage media is prepared in a ratio of 9 volumes LB media and 1 volume of this 10X Freezer Media (FM).

FE (formamide/EDTA): 5:1 (v/v) formamide:50 mM EDTA

		10 ul		ddH2O
		10 ul		100 mM EDTA
		100 ul		deionized formamide 
	make fresh

10X Fill-in/Kinase buffer: 500 mM Tris-HCl, pH 7.6, 100 mM MgCl2, 10 mM DTT, and 50 ug/ml BSA in double distilled water.

		5 ml		1 M Tris-HCl, pH 7.6
		1 ml		1 M MgCl2
		100 ul		1 M DTT
		500 ul		1 mg/ml BSA
		3.4 ml		ddH2O
		10 ml

Fill-in Deoxynucleotide Preparation: To make 4 ml of the fill-in nucleotides at a concentration of 0.25 mM of each nucleotide, combine the following:

	500 ul PCR dNTPs (2 mM)
	3500 ul ddH2O

Aliquot this into 0.5 ml eppendorf tubes with 10 ul in each tube.

To make 4 ml of these nucleotides at a final concentration of 0.25 mM from the stock 100 mM solutions, add the following:

	10 ul	100 mM dATP
	10 ul	100 mM dCTP
	10 ul	100 mM dGTP
	10 ul	100 mM dTTP
	3.6 ml	ddH2O

Aliquot into 0.5 eppendorf tubes with 10 ul in each tube.

To order these nucleotides, call Pharmacia at 1 800-526-3593 and use customer number 6933. Order the dNTP set: 27-2035-01 dNTP set (100mM each dATP, dCTP, dGTP, dTTP- each in 250 ul volume) $174.00 for the set.

20% glucose:

		20 g	d-glucose
		ddH2O to 100 ml 
	filter sterilize

Sterile glycerin (sterile glycerol):

Either autoclave the bottle of ACS grade Glycerin (Fisher Scientific #G33-500) with loosened cap after putting autocalve tape on the bottle (to indicate that it has been autoclaved) or we make a 50% solution of the same Glycerin with ultrapure water (which then is easier to work with) and autoclave that in a convenient size bottle.

6 M guanidine HCl, pH 6.4, containing 50 mM Tris-HCl, 20 mM EDTA:

		573.18 g	guanidine-HCl (Sigma G-4505)
		50 ml		1 M Tris-HCl, pH 7.6
		40 ml		0.5 M EDTA, pH 8.0
		ddH2O to 1 liter

GET/lysozyme solution: 50 mM glucose, 25 mM Tris-HCl, pH 8.0, and 10 mM EDTA, pH 8.0 in double distilled water,

		0.9 g		d-glucose
		2.5 ml		1 M Tris-HCl, pH 8.0
		2 ml		0.5 M EDTA, pH 8.0
		ddH2O to 100 ml (filter sterilize and store at 4degC).

Add 2 mg/ml lysozyme (Sigma L-6876) just before use.

1 M HEPES, pH 7.5:

		23.83 g	HEPES (Sigma H-3375)
		ddH2O to 100 ml

adjust pH to 7.5 with potassium hydroxide (KOH) (store at 4deg.C).

IPTG (isopropyl b-D-thiogalactopyranoside):25 mg/ml IPTG in double distilled water

		250 mg	IPTG (Sigma I-5502)
		ddH2O to 10 ml (aliquot and store at -20degC)

1 M isocitrate (sodium salt-dihydrate):

		29.41 g	Na3isocitrate-2H2O (Sigma C-7254)
		ddH2O to 100 ml

10x Kinase buffer: 500 mM Tris-HCl, pH 7.6, 100 mM MgCl2, and 100 mM DTT in sterile double distilled water.

		5 ml		1 M Tris-HCl, pH 7.6
		1 ml		1 M MgCl2
		1 ml		1 M DTT
		sddH2O to 10 ml (store in 25 ml aliquots at -20deg.C).

Kanamycin sulfate (Kan): Stock of 5 mg/ml in sterile double distilled water (sddH2O).

		0.5 g	Kanamycin (Boehringer Mannheim 106 801)
		sddH2O to 100 ml (Add to media for final conc. 20 ug/ml)

1M KCl (potassium chloride):

		7.5 g		KCl
		ddH2O to 100 ml

Lambda plates:

		10 g		Bacto-tryptone (Difco 0123-01-1)
		15 g		Bacto-agar (Difco 0140-01)
		2.5 g		NaCl
		ddH2O to 1 L

autoclave to sterilize and pour into sterile petri dishes (approx. 20 ml/plate).

Lambda top agar:

		10 g		Bacto-tryptone (Difco 0123-01-1)
		10 g		Bacto-agar (Difco 0140-01)
		5 g		NaCl
		ddH2O to 1 L

autoclave to sterilize

LB Medium:

		10 g		Bacto-Tryptone (Difco 0123-01-1)
		5 g		Bacto-yeast extract (Difco 0127-05-3)
		10 g		NaCl
		ddH2O to 1 L 
        adjust the pH to 7.0 and then
	autoclave to sterilize

(p> LB plates:

		10 g		Bacto-Tryptone (Difco 0123-01-1)
		5 g		Bacto-yeast extract (Difco 0127-05-3)
		10 g		NaCl
		15 g		Bacto-agar (Difco 0140-01)
		ddH2O to 1 L

autoclave to sterilize, cool to 55deg.C, add antibiotic if desired, and pour into sterile petri dishes (approx. 20 ml/plate).

10x Ligation buffer: 50 mM Tris-HCl, pH 7.6, 10 mM MgCl2, 10 mM DTT, 10 mM rATP, and 250 ug/ml bovine serum albumin (BSA) in sterile double distilled water.

		5 ml		1 M Tris-HCl, pH 7.6
		1 ml		1 M MgCl2
		1 ml		1 M DTT
		1 ml		100 mM rATP
		2.5 mg	BSA
		sddH2O to 10 ml (store in 25 ml aliquots at -20deg.C)

Loading dye: 0.3% xylene cyanole FF, 0.3% bromophenol blue, 10 mM EDTA in deionized formamide.

		3 g		xylene cyanole FF
		3 g		bromophenol blue
		0.2 ml		0.5 M EDTA
		deionized formamide to 10 ml

Lysozyme solution: 50 mM Tris-HCl, pH 8.0, 10 mM EDTA, and 5 mg/ml lysozyme in sterile double distilled water.

		5 ml		1 M Tris-HCl, pH 8.0
		2 ml		0.5 M EDTA
		0.5 g		lysozyme (Sigma L-6876)
		sddH2O to 100 ml (make fresh)

M-9 Agar: Add 15 g. agar to 870 ml. double distilled water in a 2 L Ehrlenmeyer flask and autoclave. Also autoclave a 100 ml. graduate cylinder capped with aluminum foil to use for measuring the sterile M-9 salts later. Swirl the agar gently and carefully upon removal from autoclave to disperse any undissolved agar. Allow to cool in a 55degC water bath. When 55degC, add the ingredients called for in the M-9 liquid medium recipe, omitting the water. Be sure to use sterile pipettes or graduate cylinders, as this mixture cannot be autoclaved. Immediately pour into sterile Petri dishes, using sterile technique.

M-9 Medium (liquid):

		100 ml		10X M-9 salts
		1 ml		1 M MgSO4 (autoclaved)
		10 ml		20% glucose (filter sterilized),
		1 ml		1% thiamine (filter sterilized)
		10 ml		100 mM CaCl2 (autoclaved)
		sddH2O to 1 L

10X M-9 Salts:

		60 g		Na2HPO4 (sodium phosphate, dibasic)
		30 g		KH2PO4 (potassium phosphate, monobasic)
		5 g		NaCl
		10 g		NH4Cl (ammonium chloride)
		ddH2O to 1 liter (autoclave)

1 M MgCl2 (magnesium chloride):

		20.33 g	MgCl2-6H2O
		ddH2O to 100 ml

1 M MgSO4 (magnesium sulfate):

		12.04 g	MgSO4
		ddH2O to 100 ml  (autoclave)

1 M MnCl2 (manganese chloride):

		1.98 g		MnCl2 (Sigma M-8530)
		ddH2O to 10 ml (store protected from light)

1 M MOPS:

		20.93 g	MOPS (Sigma M-1254)
	Dissolve in 80 ml ddH2O, adjust pH to 7.5 with 1 N NaOH, and bring volume to
100 ml.

10X MOPS buffer: 400 mM MOPS, pH 7.5, 500 mM NaCl, 100 mM MgCl2 in double distilled water.

		400 ul	1 M MOPS, pH 7.5
		170 ul	3 M NaCl
		100 ul	1 M MgCl2
		330 ul	ddH2O
		1 ml

2.7 M MOPS (acid form):

		5.65 g		MOPS (acid form)
		ddH2O to 10 ml

MOPS-Acid buffer: 1.35 M MOPS (acid form), 100 mM MgCl2 in double distilled water.

		500 ul		2.7 M MOPS (acid form)
		100 ul		1 M MgCl2
		400 ul		ddH2O
		1 ml

10X Mn2+/isocitrate buffer: 50 mM MnCl2, 150 mM isocitrate (Na salt), 25% glycerol in double distilled water

		50 ul		1 M MnCl2
		150 ul		1 M isocitrate
		250 ul		glycerol
		550 ul		ddH2O
		1 ml

10x MTBE (Modified Tris-borate-EDTA buffer): 1.3 M Tris, 0.4 M Boric acid, and 0.02 M EDTA in double distilled water.

		162 g		Tris base
		27.5 g		Boric acid
		9.3 g		Na2EDTA
		ddH2O to 1 L

Nucleotide ordering information:

	100 mM dATP	27-2050-01	Pharmacia
	100 mM dCTP	27-2060-01	Pharmacia
	100 mM dGTP	27-2070-01	Pharmacia
	10 mM c7dGTP	988 537	Boehringer-Mannheim
	100 mM dTTP	27-2080-01	Pharmacia
	5 mM ddATP	27-2057-00	Pharmacia
	5 mM ddCTP	27-2065-00	Pharmacia
	5 mM ddGTP	27-2075-00	Pharmacia
	5 mM ddTTP	27-2085-00	Pharmacia

20 mM dNTP stocks: Prepare from 100 mM stocks

		80 ul		100 mM dNTP
		40 ul		50:1 TE buffer
		280 ul		ddH2O 
		400 ul

5 mM dNTP stocks: Prepare from 20 mM stocks

		25 ul		20 mM dNTP
		10 ul		50:1 TE buffer
		65 ul		ddH2O
		100 ul

2 mM dNTPs: 2 mM dATP, dCTP, dGTP, and dTTP in 5 mM Tris-HCl, pH 7.6, 0.1 mM EDTA

		100 ul		20 mM dATP
		100 ul		20 mM dCTP
		100 ul		20 mM dGTP
		100 ul		20 mM dTTP
		100 ul		50:1 TE buffer
		500 ul		ddH2O 
		1 ml

2 mM [alpha]-S-dNTPs: 2 mM [alpha]-S-dATP, [alpha]-S-dCTP, [alpha]-S-dGTP, and [alpha]-S-dTTP in 5 mM Tris-HCl, pH 7.6, 0.1 mM EDTA

		100 ul		20 mM [alpha]-S-dATP
		100 ul		20 mM [alpha]-S-dCTP
		100 ul		20 mM [alpha]-S-dGTP
		100 ul		20 mM [alpha]-S-dTTP
		100 ul		50:1 TE buffer
		500 ul		ddH2O 
		1 ml

3M NaCl (sodium chloride):

		17.53 g	NaCl
		ddH2O to 100 ml

10N NaOH (sodium hydroxide):

		40 g	NaOH
		ddH2O to 100 ml.

1N NaOH:

		10 ml 	10 N NaOH
		ddH2O to 100 ml

9.5M NH4OAc (ammonium acetate):

		73.23 g	NH4OAc
		ddH2O to 100 ml

8.0M NH4OAc:

		61.69 g	NH4OAc
		ddH2O to 100 ml

10X PCR buffer: 500 mM KCl, 100 mM Tris-HCl, pH 8.5, 15 mM MgCl2 in sterile double distilled water

		5 ml		1 M KCl
		1 ml		1 M Tris-HCl, pH 8.5
		150 ul		1 M MgCl2
		ddH2O to 10 ml

PCR Deoxynucleotide Preparation: To make 12.5 ml of the PCR nucleotides at a concentration of 2 mM each nucleotide, combine the following:

	250 ul 100 mM dATP
	250 ul 100 mM dCTP
	250 ul 100 mM dGTP
	250 ul 100 mM dTTP
	11.5 ml ddH2O

Aliquot this into 25 tubes with 500 ul in each tube. This will keep the nucleotides from being frozed and thawed too much.

To order these nucleotides, call Pharmacia at 1 800-526-3593 and use customer number 6933. Order the dNTP set: 27-2035-01 dNTP set (100mM each dATP, dCTP, dGTP and dTTP- each in 250 ul volume)$174.00 for the set.

20% PEG/2.5 M NaCl:

		7.3 g		NaCl
		10 g		PEG (MW=8000) (Fisher P156-3)

Dissolve in 40 ml double distilled water by stirring, and then adjust the volume to 50 ml.

50% PEG/0.5 M NaCl:

		5.85 g		NaCl
		100 g		PEG (MW=8000) (Fisher P156-3)

Dissolve in 100 ml double distilled water by stirring, and then adjust the volume to 200 ml.

PEG:TE rinse solution: 1:3 solution of 20% PEG containing 2.5M NaCl and 10 mM Tris-HCl, pH 8.0 containing 1 mM EDTA in double distilled water.

		250 ul		1 M Tris-HCl, pH 8.0
		50 ul		0.5 M EDTA
		12.5 ml		20% PEG/2.5 M NaCl.
		ddH2O to 37.5 ml

Phenol, TE-saturated: add an equal volume of 10 mM Tris-HCl, pH 7.5-8.0, 1 mM Na2EDTA to ultrapure phenol, mix well, allow phases to separate, remove and discard upper (aqueous) phase. Repeat until the pH of the aqueous phase is between 7.5-8.0 (store at 4deg. C).

Phenol/chloroform/isoamyl alcohol (25:25:1):

		100 ml			TE-saturated phenol
		100 ml			chloroform
		4 ml 		isoamyl alcohol
		204 ml

2M NaOAc (sodium acetate):

		27.22 g	NaOAc-3H2O
		ddH2O to 100 ml

3M NaOAc, pH 4.5:

		408.24 g	NaOAc-3H2O

Dissolve in approx. 800 ml ddH2O , adjust pH to 4.8 with glacial acetic acid and bring to a final volume of 1 L with ddH2O.

Restriction enzyme assay buffer, 10X Low Salt: 100 mM Tris-HCl, pH 7.6, 100 mM MgCl2, and 10 mM DTT in sterile double distilled water.

		1 ml		1 M Tris-HCl, pH 7.6
		1 ml		1 M MgCl2
		0.1 ml		1 M DTT
		ddH2O to 10 ml

Restriction enzyme assay buffer, 10X Medium Salt: 500 mM NaCl, 100 mM Tris-HCl, pH 7.6, 100 mM MgCl2, and 10 mM DTT in sterile double distilled water.

		1.7 ml		3 M NaCl
		1 ml		1 M Tris-HCl, pH 7.6
		1 ml		1 M MgCl2
		0.1 ml		1 M DTT
		ddH2O to 10 ml

Restriction enzyme assay buffer, 10X High Salt: 1M NaCl, 500 mM Tris-HCl, pH 7.6, 100 mM MgCl2, and 10 mM DTT in sterile double distilled water.

		3.3 ml		3 M NaCl
		5 ml		1 M Tris-HCl, pH 7.6
		1 ml		1 M MgCl2
		0.1 ml		1 M DTT
		ddH2O to 10 ml

Restriction enzyme assay buffer, 10X SmaI: 200 mM KCl, 100 mM Tris-HCl, pH 7.6, 100 mM MgCl2, and 10 mM DTT in sterile double distilled water.

		2 ml		1 M KCl
		1 ml		1 M Tris-HCl, pH 7.6
		1 ml		1 M MgCl2
		0.1 ml		1 M DTT
		ddH2O to 10 ml

RNase T1: 100 U/ul in 50 mM Tris-HCl, pH 7.6

		100 ul		RNase T1 (Sigma R-8251) (100,000 U/0.2 ml)
		25 ul		1 M Tris-HCl, pH 7.6
		375 ul		ddH2O
		500 ul

10% SDS (sodium dodecyl sulfate):

		10 g		SDS (Fisher S529-3)
		ddH2O to 100 ml

1X STB buffer: 25% sucrose and 50 mM Tris-HCl, pH 8.0 in double distilled water.

		25 g		sucrose
		5 ml		1 M Tris-HCl, pH 8.0 
		ddH2O to 100 ml (filter sterilize and store at 4degC)

Silanizing reagent: 5% solution of dichloro dimethyl silane in 1,1,1-trichloroethane.

20X SSC (standard saline-citrate):

		17.53 g		NaCl
		8.82 g		sodium citrate

Dissolve in approx. 80 ml ddH2O, adjust pH to 7.0 with hydrochloric acid (HCl) and bring final volume to 100 ml.

1X SSC (standard saline-citrate):

		5 ml		20X SSC
		95 ml		ddH2O
		100 ml

5X Taq reaction buffer: 400 mM Tris-HCl, pH 9.0, 100 mM ammonium sulfate ((NH4)2SO4), pH 9.0, 25 mM MgCl2, and 5% dimethyl sulfoxide (DMSO) in sterile double distilled water.

		16 ml		1 M Tris-HCl, pH 9.0
		4 ml		1 M (NH4)2SO4, pH 9.0
		1 ml		1 M MgCl2
		2 ml		DMSO
		17 ml		ddH2O
		40 ml

5X Taq dilution buffer: 400 mM Tris-HCl, pH 9.0, 100 mM (NH4)2SO4, pH 9.0, and 25 mM MgCl2 in sterile double distilled water.

		16 ml		1 M Tris-HCl, pH 9.0
		4 ml		1 M (NH4)2SO4, pH 9.0
		1 ml		1 M MgCl2
		19 ml		ddH2O
		40 ml

5X Taq "A" termination mix: 62.5 uM dATP, 250 uM dCTP, 375 uM c7dGTP, 250 uM dTTP and 1.5 mM ddATP in 5 mM Tris-HCl, pH 7.6 and 0.1 mM EDTA.

		20 ul 		20 mM dATP
		80 ul		20 mM dCTP
		240 ul		10 mM 7deaza-dGTP
		80 ul		20 mM dTTP
		1920 ul		5 mM ddATP
		640 ul		50:1 TE buffer
		3420 ul		sddH2O
		6.4 ml

5X Taq "C" termination mix: 250 uM dATP, 62.5 uM dCTP, 375 uM c7dGTP, 250 uM dTTP and 0.75 mM ddATP in 5 mM Tris-HCl, pH 7.6 and 0.1 mM EDTA.

		80 ul 		20 mM dATP
		20 ul		20 mM dCTP
		240 ul		10 mM 7deaza-dGTP
		80 ul		20 mM dTTP
		960 ul		5 mM ddCTP
		640 ul		50:1 TE buffer
		4380 ul		sddH2O
		6.4 ml

5X Taq "G" termination mix: 250 uM dATP, 250 uM dCTP, 94 uM c7dGTP, 250 uM dTTP and 0.125 mM ddGTP in 5 mM Tris-HCl, pH 7.6 and 0.1 mM EDTA.

		160 ul 		20 mM dATP
		160 ul		20 mM dCTP
		120 ul		10 mM 7deaza-dGTP
		160 ul		20 mM dTTP
		320 ul		5 mM ddGTP
		1280 ul		50:1 TE buffer
		10600 ul	sddH2O
		12.8 ml

5X Taq "T" termination mix: 250 uM dATP, 250 uM dCTP, 375 uM c7dGTP, 62.5 uM dTTP and 1.25 mM ddTTP in 5 mM Tris-HCl, pH 7.6 and 0.1 mM EDTA.

		160 ul 		20 mM dATP
		160 ul		20 mM dCTP
		480 ul		10 mM 7deaza-dGTP
		40 ul		20 mM dTTP
		3200 ul		5 mM ddTTP
		1280 ul		50:1 TE buffer
		7480 ul		sddH2O
		12.8 ml

20X TAE buffer: 0.8 M Tris, 0.4 M NaOAc, and 0.04 M Na2EDTA, and glacial acetic acid to pH 8.3 in double distilled water.

		96.9 g		Tris base
		32.8 g		NaOAc-3H2O
		14.9 g		Na2EDTA

Dissolve in approx. 700 ml of double distilled water, adjust the pH to 8.3 with glacial acetic acid, and bring to 1 L with ddH2O.

TEMED (N,N,N',N'-tetramethylethylenediamine): Kodak T-7024, store protected from light at 15degC.

10xTB Salts:

		2.31 g		KH2PO4
		12.54 g		K2HPO4 (potassium phosphate, dibasic)
		ddH2O to 100 ml autoclave)

Terrific Broth (TB):

		12 g		Bacto-tryptone
		24 g		yeast extract
		4 ml		glycerol
		ddH2O to 900 ml

Autoclave, cool and add 100 ml of 10xTB Salts and adjust the final volume to 1 L with sddH2O.

TE (10:0.1) buffer:10 mM Tris-HCl, pH 7.6, 0.1 mM EDTA

		10 ml		1 M Tris-HCl, pH 7.6
		0.2 ml		0.5 M EDTA
		ddH2O to 1 L

TE (10:1) buffer: 10 mM Tris-HCl, pH 7.6, 1 mM EDTA

		10 ml		1 M Tris-HCl, pH 7.6
		2 ml		0.5 M EDTA
		ddH2O to 1 L

TE (100:10) buffer: 100 mM Tris-HCl, pH 7.6, 10 mM EDTA

		100 ml		1 M Tris-HCl, pH 7.6
		20 ml		0.5 M EDTA
		ddH2O to 1 L

TE (50:1) buffer: 50 mM Tris-HCl, pH 7.6, 1 mM EDTA

		0.5 ml		1 M Tris-HCl, pH 7.6
		0.1 ml		100 mM EDTA
		9.4 ml 	ddH2O 
		10 ml

TE-RNase solution: 50:10 TE buffer containing 40 ug/ml RNase A and 40 U/ml RNase T1

		1.2 ml		1 M Tris-HCl, pH 7.6
		480 ul		0.5 M EDTA
		50 ul		20 mg/ml RNase A
                10 ul           100U/ul RNase T1
		22.3 ml 	ddH2O 
		24.0 ml

Tetracycline stock (Tet): Stock of 10 mg/ml in 50% ethanol + sddwater.

		1 g		Tetracycline (Sigma T-3383)
		50 ml		100% ethanol
		sddH2O to 100 ml (store at 4deg.C in the absence of light)

Add to media for final conc. 20 ug/ml.

1% thiamine:

		100 mg	thiamine (Sigma T-4625)
		sddH2O to 10 ml (filter sterilized)

1M Tris-HCl, pH 7.6, 8.0, 8.5, 9.0, 9.5:

		121.1 g	Tris base
		ddH2O to 800 ml

Adjust pH with concentrated HCl and then add ddH2O to 1 L.

10X TM buffer: 500 mM Tris-HCl, pH 8.0, 150 mM MgCl2 in sterile double distilled water.

		5 ml		1 M Tris-HCl, pH 8.0
		1.5 ml		1 M MgCl2
		sddH2O to 10 ml

50:2:10 TTE: 50 mM Tris-HCl, pH 8.0, 2% Triton X-100, and 10 mM EDTA in double distilled water.

		5 ml		1 M Tris-HCl, pH 8.0
		2 ml		0.5 M EDTA
		2 ml		Triton X-100 (Sigma X-100)
		ddH2O to 100 ml

TTE: 10 mM Tris-HCl, pH 8.0, 0.5% Triton X-100, and 0.1 mM EDTA in double distilled water.

		500 ul		1 M Tris-HCl, pH 8.0
		250 ul		Triton X-100 (Sigma X-100)
		10 ul		0.5 M EDTA
		ddH2O to 50 ml

X-gal (5-bromo-4-chloro-3-indolyl b-D-galactopyranoside):

		200 mg	x-gal (Sigma B-4252)
		dimethylformamide (DMF) to 10 ml
		Aliquot and store protected from light at -20degC)

2xTY medium:

		16 g		Bacto-tryptone (Difco 0123-01-1)
		10 g		Bacto-yeast extract (Difco 0127-05-3)
		5 g		NaCl
		ddH2O to 1 L (autoclave)

Primers:


        ABI Forward primer sequence-
            20mer  5' GACGTTGTAAAACGACGGCC 3'
            18mer  5' TGTAAAACGACGGCCAGT 3'

	ABI Forward Aminolink-primer sequence-
		5' 5TG TAA AAC GAC GGC CAG T 3'

        ABI Reverse primer sequence-
            20mer  5' CACAGGAAACAGCTATGACC 3'
            18mer  5' CAGGAAACAGCTATGACC 3'

	ABI Reverse Aminolink-primer sequence-
		5' 5CA GGA AAC AGC TAT GAC C 3'

Bruce A. Roe, Department of Chemistry and Biochemistry, The University of Oklahoma, Norman, Oklahoma 73019 broe@ou.edu