Oligonucleotide universal primers used for DNA sequencing

At present, we are using the following primers:

Universal Forward 20mer 5' GTTGTAAAACGACGGCCAGT 3'

Universal Reverse 20mer 5' CACAGGAAACAGCTATGACC 3'

The following primers also have been used in the past:

ABI Forward primer sequence-

20mer 5' GACGTTGTAAAACGACGGCC 3'

18mer 5' TGTAAAACGACGGCCAGT 3'

ABI Reverse primer sequence-

20mer 5' CACAGGAAACAGCTATGACC 3'

18mer 5' CAGGAAACAGCTATGACC 3'

T7: 5'-TAA-TAC-GAC-TCA-CTA-TAG-GG-3'

SP6:5'-ATT-TAG-GTG-ACA-CTA-TAG-AA-3'

M13 (-21) universal forward 5'-TGT-AAA-ACG-ACG-GCC-AGT-3'

M13 (-40) universal forward 5'-GTT-TTC-CCA-GTC-ACG-AC-3'

M13/pUC reverse primer 5'-CAG-GAA-ACA-GCT-ATG-ACC-3'

T7 primer 5'-TAA-TAC-GAC-TCA-CTA-TAG-GG-3'

SP6 primer 5'-ATT-TAG-GTG-ACA-CTA-TAG-3'

-16bs 5'-TCG-AGG-TCG-ACG-GTA-TCG-3'

+19bs 5'-GCC-GCT-CTA-GAA-CTA-GTG-3'

Listing of M13 (pUC) cloning sites

As they are read on DNA sequencing gels using the Universal primer:

M13mp7
.......EcoR1....BamH1.SalI..PstI..SalI..BamH1....EcoR1
GGCCAGTGAATTCCCCGGATCCGTCGACCTGCAGGTCGACGGATCCGGGGAATTC

M13mp8
..........HindIII.PstI.SalI...BamH1.SmaI.EcoR
GGCCAGTGCCAAGCTTGGCTGCAGGTCGACGGATCCCCGGGAATTCGTAATCATG

M13mp9
.......EcoR1.SmaI.BamH1..SalI..PstI..HindIII
GGCCAGTGAATTCCCGGGGATCCGTCGACCTGCAGCCAAGCTTGGCGTAATCATG

M13mp10 ...HindIII..PstI..SalI..XbaI..BamH1..SmaI..SstI..EcoR1 GCCAAGCTTGGGCTGCAGGTCGACTCTAGAGGATCCCCGGGCGAGCTCGAATTCG M13mp11 ...EcoR1..SstI..SmaI..BamH1..XbaI..SalI..PstI..HindIII GTGAATTCGAGCTCGCCCGGGGATCCTCTAGAGTCGACCTGCAGCCCAAGCTTGG M13mp18 HindIII.SphI..PstI..SalI.XbaI.BamH1.SmaI.KpnI.SstI.EcoR1 AAGCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCGGGTACCGAGCTCGAATTC M13mp19 EcoR1.SstI.KpnI.SmaI.BamH1.XbaI.SalI.PstI..SphI..HindIII GAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTT

Commonly used restriction enzymes and assay buffers

Common Assay Incub. Recognition

Enzyme isoschizomers buffer temp. site Cloning sites

Aat II		med	37	GACGT/C	Aat II
Acc I 		med	37	GT/(AC)(GT)AC	Acc I, Cla I
Aha III	Dra I	med	37	TTT/AAA	blunt
Alu I		med	37	 AG/CT	blunt
Asu II			37	TT/CGAA	Acc I, Cla I
Ava I		med	37	C/YCGRG	Sal I, Xho I, Xma I
Ava II		med	37	G/G(AT)CC	
Bal I		low	37	TGG/CCA	blunt
BamH1		med	37	G/GATCC	BamH1, Bgl II
Bgl I		med	37	GCCN4/NGGC
Bgl II		low	37	A/GATCT	BamH1, Bgl II
BstE II		high	60	G/GTNACC
BstN I		low	55	CC/(AT)GG
Cla I		low	37	AT/CGAT	Acc I, Cla I
Dra I	Aha III	low	37	TTT/AAA	blunt
EcoR1		high	37	G/AATTC	EcoR1
EcoR1*		low	37	  /AATT	EcoR1
EcoRV		med	37	GAT/ATC	blunt
Hae I		low	37	(AT)GG/CC(TA)	blunt
Hae II		low	37	RGCGC/Y	
Hae III		med	37	GG/CC	blunt
Hha I	Cfo I, HinP1	med	37	GCG/C	Hha I
Hinc II		med	37	GTY/RAC	blunt
Hind III		med	37-55	A/AGCTT	Hind III
Hinf I		med	37	G/ANTC
HinP1	Cfo I, Hha I	low	37	G/CGC	Acc I, Cla I
Hpa I		low	37	GTT/AAC	blunt
Hpa II	Msp I	low	37	C/CGG	Acc I, Cla I
Kpn I		low	37	GGTAC/C	Kpn I
Mbo I	Sau3A	med 	37	  /GATC	BamH1, Bgl II
Msp I		med	37	C/CGG	Acc I, Cla I
Mst I	Fsp I	high	37	TGC/GCA	blunt
Mst II	Bsu36 I	high	37	CC/TNAGG
Nae I		med	37	GCC/CCG	blunt
Nco I		high	37	C/CATGG	Nco I
Nde I		med	37	CA/TATG	Nde I
Not I		high	37	GC/GGCCGC
Nru I		med	37	TCG/CGA	blunt
Pst I		med	21-37	CTGCA/G	Pst I
Pvu I		high	37	CGAT/CG	Pvu I
Pvu II		med	37	CAG/CTG	blunt
Rsa I		med	37	  GT/AC	blunt
Sac I	Sst I	low	37	GAGCT/C	Sac I, Sst I
Sal I		high	37	G/TCGAC	Ava I, Sal I, Xho I
Sau3A I	Mbo I	med	37	 /G*ATC	BamH1, Bgl II
Sfi I			50	GGCCN4/NGGCC
Sma I	Xma I	(1)	37	CCC/GGG	blunt
Sph I		high	37	GCATG/C	Sph I
Sst I	Sac I	med 	37	GAGCT/C	Sst I, Sac I
Sst II	Sac II	med	37	CCGC/GG	Sst II
Taq I		low	37-55	T/CGA	AccI, Cla I
Tha I	FnuD II, Acc II	low	37-60	  CG/CG	blunt
Xba I		high	37	T/CTAGA	Xba I
Xho I	Ccr I	high	37	C/TCGAG	Ava I, Cla I
Xma I	Sma I	low	37	C/CCGGG	Ava I, Xma I

Assay buffers (see enzyme vendors catalogs for additional information)

10x Low salt buffer			10x Core buffer

   100mM Tris-HCl, pH 7.6 500mM NaCl
   100mM MgCl2            500mM Tris-HCl, pH 7.6
    10mM DTT              100mM MgCl2

10x Medium salt buffer		10x Hind buffer

   500mM NaCl               600mM NaCl
   100mM Tris-HCl, pH 7.6   100mM Tris-HCl, pH 7.6
   100mM MgCl2               70mM MgCl2
    10mM DTT

10x High salt buffer 10x Sma I buffer (1) 1.0M NaCl 200mM KCl 500mM Tris-HCl, pH 7.6 100mM Tris-HCl, pH 7.6 100mM MgCl2 100mM MgCl2 10mM DTT 10mM DTT

The following enzymes CAN be heat inactivated by incubation at 65 deg. C for 10 min.

Alu I, Apa I, Ava II, Bal I, Bgl I, Cvn I, Dpn I, Dra I, Eco R II, Eco RV, Hae II, Hha I, Hinc II, Kpn I, Mbo I, Msp I, Nar I, Nde II, Rsa I, Sau 3a, Sca I, Sfi I, Spe I, Sph I, Ssp I, Sst I, Stu I, and Sty I.

The following enzymes are ONLY PARTIALLY heat inactivated by incubation at 65 deg.C for 10 min.

Ava I, Cfo I, Cla I, Cvn I, Eco RI, Mbo II, Mlu I, Nci I, Nru I, Pst I, Pvu II, Sma I and Xma III

The following enzymes CANNOT be heat inactivated by incubation at 65 deg. C for 10 min.

Acc I, Bam HI, Bcl I, Bgl II, BstE II, Dde I, Hae III, Hind III, Hinf I, Hpa I, Hpa II Nde I, Nhe I, Nsi I, Pvu I, Sal I, Sau 96 I, Sst II, Taq I, Tha I, Xba I, Xho I, and Xor II.


Bruce A. Roe, Department of Chemistry and Biochemistry, The University of Oklahoma, Norman, Oklahoma 73019 broe@ou.edu