Primer Selection

The oligo selection engine is the one used in the program OSP. It is described in Hillier, L., and Green, P. (1991). "OSP: an oligonucleotide selection program," PCR Methods and Applications, 1:124-128. Oligo selection is a complex operation. The normal mode of use is outlined below:

1. Open the oligo selection window, by selecting "Select Primer" from the contig editor commands menu.
2. Position the cursor to where you want the oligo to be chosen. While the oligo selection window is visible, you will still have complete control over positioning and editing within the contig editor.
3. Indicate the strand for which you require an oligo. This is done by toggling the direction arrow ("----->" or "<------"), if necessary.
4. Press the "Find Oligos" button to find all suitable oligos (see the "Parameters" subsection below for further information on controlling this procedure). Information for the closest oligo to the cursor position is given in the output text window. In the contig editor the position of the oligo is marked by a temporary tag on the consensus. The window is recentered if the oligo is off the screen. Selecting "Display Selection Information" will print a short report on the numbers of oligos considered and rejected during oligo selection.
5. If this oligo is not suitable (it may have been previously chosen, and found to be unsuitable by experimentation, say), the next closest oligo can be viewed by pressing "Select Next".
6. Suitable templates are automatically identified for the currently displayed oligo (see the "Template selection" subsection below). By default, the template is that closest to the oligo site. If the choice is not suitable (it may be known to be a poor quality template, say) another can be chosen from the "Choose Template for this Oligo" menu. Templates that do not appear on the menu can be specified by selecting "other". However, the template must be on the correct strand and be upstream of the oligo.
7. A tag can be created for the current oligo by pressing the button "Create a tag for this oligo". The annotation for this tag holds the name of the template and the oligo primer sequence. There are fields to allow the user to specify their own primer name ("serial#") and comments ("flags") for this tag. An example of oligo tag annotation:

    serial#=
    template=a16a9.s1
    sequence=CGTTATGACCTATATTTTGTATG
    flags=
   

8. The oligo selection window is closed when "Create a tag for this oligo" or "Quit" is selected.

Parameters

The parameters controlling the selection of oligos can be changed in the "Oligo Selection Parameters" window. The weights controlling the scoring of selected oligos can be changed in the "Oligo Selection Weights" window.

By default, the oligos are selected from a window that extends 40 bases either side of the cursor. The size and location of this window relative to the cursor position can be changed in the "Parameters" window.

In Gap oligos are ranked according to their proximity to the cursor position, rather than by their scores.

Template selection

For simplicity, each reading is considered to represent a template. In practise, many readings can be made of the same template. Suitable templates that are identified are those that satisfy all of the following conditions:

1. are in the appropriate sense,
2. have 5' ends that start upstream of the oligo,
3. are sufficiently close to the oligo to be useful.

This last criterion relates to the insert size for the templates used for sequencing and the average reading length. A template is considered useful if a full reading can be made from it, taking into account both of these factors. The default insert size is 1000 bases (although the size range should be included in the experiment file for each reading, and hence the default would not be required), and the default average reading length is 400 bases. These values can be changed in the "Parameters" window.