Suggest Probes

The suggest probes function looks for oligos at the end of each contig suitable for use with an oligo probing strategy as suggested by Jonathan Flint. (FIXME: DESCRIPTION TO FOLLOW.)

The dialogue contains the usual methods of selecting the set of contigs to operate on. For each end of the chosen contigs oligos are firstly chosen using the OSP selection criteria, which is dependent on the maximum and minimum size of oligos specified. The "search from" and "search to" parameters control the area of consensus sequence to search for oligos within. For instance, if they are set to 10 and 100 respectively the a section of consensus sequence is used that is 90 bases long and starts 10 bases from the end of the contig.

Once an oligo is found it is then screened against all the existing consensus sequence. An oligo is rejected if it matches with a score greater than or equal to the "maximum percentage match". If a file of vector filenames has been specified then the oligos are also screened against the vector sequences.

Typical output for a single contig follows. The output shows all oligos that have passed the screening process. The information listed includes the distance of this oligo from the end of the contig (Dist ??), the score returned from the OSP selection (primer=??), the best percentage match found (match=??%) and the oligo sequence.

Contig zf01g7.s1(388): Start
    Dist  38, primer=16, match=74%, GAGTTACATAGTGAAACAG
    Rejected 1 oligo due to non uniqueness
Contig zf01g7.s1(388): End
    Dist  67, primer=16, match=71%, ATCATACTCTGTGCCTC
    Dist  35, primer=20, match=74%, CATTAATCTCAAAGTCTCC
    Dist  30, primer=20, match=70%, CATTACATTAATCTCAAAGT
    Rejected 2 oligos due to non uniqueness