Align sequences

This function will produce an optimal alignment of two segments of the sequence. The dynamic programming alignment algorithm is based on Huang,X On global sequence alignment. CABIOS 10 227-235 (1994). There is no length limit of the sequences but the sequences to be aligned should be of the same type i.e. both be DNA or both protein.

A dialogue box (shown above) requests the range over which the two sequences are to be aligned and the gap start penalty and the gap extension penalty.

The alignment is displayed in the output window along with the percentage mismatch (see below).

 Percentage mismatch  29.6
                1        11        21        31        41        51
      hsproperd gagcctatcaacccagataaagcgggacctcctctctggtagaggtgcagggggcagtac
                                                                            
       mmproper ************************************************************
             -157      -147      -137      -127      -117      -107

               61        71        81        91       101       111
      hsproperd tcaacatgatcacagagggagcgcaggcccctcgattgttgctgccgccgctgctcctgc
                                                                            
       mmproper ************************************************************
              -97       -87       -77       -67       -57       -47

              121       131       141       151       161       171
      hsproperd tgctcaccctgccagccacaggctcagaccccgtgctctgcttcacccagtatgaagaat
                                                      :: :::::::::::::: :: :
       mmproper **************************************tgtttcacccagtatgaggagt
              -37       -27       -17        -7         3        13

              181       191       201       211       221       231
      hsproperd cctccggcaagtgcaagggcctcctggggggtggtgtcagcgtggaagactgctgtctca
                :::: :::: :::::: ::::: :: ::: : :   :::: :: ::::::::::::::::
       mmproper cctctggcaggtgcaaaggcctacttgggagagacatcagggtagaagactgctgtctca
               23        33        43        53        63        73

The two aligned sequences are automatically saved in memory and can be accessed through the sequence manager. They are assigned default filenames which are based on the parent with the addition of _a"number" where "number" is a unique identifier (see the nineth and tenth entries of the sequence manager picture ( see section Sequence manager).